Biotecnología Jobs

Biotechnology is an area of science that encompasses biological systems and living organisms in order to make or modify products or processes. Various processes related to biotechnology such as research and development, documentation, etc. can be outsourced to freelancers. Expert freelancers with biotechnology knowledge and qualifications are available to bid on projects. To get started, post your job today. Contratar a Biotechnology Experts

Filtro

Mis búsquedas recientes
Filtrar por:
Presupuesto
a
a
a
Tipo
Habilidades
Idiomas
    Estado del trabajo
    12 trabajados encontrados, precios en USD
    Naming logo 1 día left

    Naming para dos emprendimientos. Ambos nombres deben estar en inglés o bien ser nombres inventados. Ambos nombres están relacionados al cuidado de la salud.

    $25 (Avg Bid)
    $25 Oferta promedio
    38 ofertas

    Hello I need an expert in Organic Chemistry urgently Please apply if you have the right expertise.

    $51 (Avg Bid)
    $51 Oferta promedio
    9 ofertas

    Using the BLAT tool on Ensembl and NCBI BLAST/ RARA protein sequencing

    $187 (Avg Bid)
    $187 Oferta promedio
    7 ofertas

    it's a project's review paper which has to be written. The material will be provided by me.

    $17 (Avg Bid)
    $17 Oferta promedio
    9 ofertas
    Genomics Variants Exploration -- 2 4 días left
    VERIFICADO

    I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

    $5 / hr (Avg Bid)
    $5 / hr Oferta promedio
    5 ofertas

    I need help solving 2 organic chemistry questions for today!

    $7 / hr (Avg Bid)
    $7 / hr Oferta promedio
    21 ofertas
    Project on vaccine and viruses 1 día left
    VERIFICADO

    Different research and report on vaccines for viruses

    $158 (Avg Bid)
    $158 Oferta promedio
    39 ofertas

    Research on several levels including chromatin organisation, transcription, RNA processing, translation and cis-regulatory elements.

    $150 (Avg Bid)
    $150 Oferta promedio
    10 ofertas

    Hello - I am looking for a skilled MEDICAL WRITER with experience in regulatory submissions, Phase 1 through 4 clinical study reports, regulatory submissions, investigator brochures, NDA documents and more. Rare disease writing is a plus but you MUST have at least 3 years experience in oncology writing. You MUST have regulatory writing experience. You must speak and write fluent English. You ...

    $40 / hr (Avg Bid)
    $40 / hr Oferta promedio
    17 ofertas

    Hello I need an expert in Organic Chemistry. Please apply if you have the right expertise.

    $91 (Avg Bid)
    $91 Oferta promedio
    23 ofertas

    We need to develop an efficient and effective algorithm for facial recognition and Liveness detection with AI capabilities.

    $5000 - $10000
    $5000 - $10000
    0 ofertas

    I need you to write a research article.

    $12 / hr (Avg Bid)
    $12 / hr Oferta promedio
    15 ofertas